 METHOD AND AGENT FOR PRODUCING N-ACETYLNEURAMIC ACID (NEUNAC)
专利摘要:
公开号:AT510299A4 申请号:T0211110 申请日:2010-12-22 公开日:2012-03-15 发明作者:Astrid Dr Mach-Aigner；Robert Dr Mach；Matthias G Dr Steiger 申请人:Univ Wien Tech； IPC主号:
专利说明:
«··· · · ·· * * * * · • ··· ·« «* * * * * I» Μ « The present invention relates to methods and means for preparing N-acetylneuraminic acid (NeuNAc). N-acetylneuraminic acid (NeuNAc) belongs to the sialic acids. In mammals, sialic acids are commonly found as the terminal residue of glycol conjugates on the cell surface. Due to its location and its negative carboxylation functionality, sialic acids play an important role in cellular recognition and adhesion processes. NeuNAc derivatives are used as neuraminidase inhibitors for the treatment of viral infections such as influenza. NeuNAc serves as a starting material for the preparation of such medicaments, e.g. Oseltamivir and Zanamivir. NeuNAc can be extracted from appropriate raw materials, such as milk and eggs, or chemically synthesized. Currently, NeuNAc is made exclusively from raw materials such as N-acetylglucosamine, with part of the known processes comprising eznymatically catalyzed steps. In WO 94/29476 a process for the preparation of NeuNAc is described in which first N-acetyl-D-glucosamine is converted to N-acetyl-D-mannosamine by epimerization. The product of this first step is then reacted with pyruvate and a NeuNAc aldolase to NeuNAc. In ESS 7,579,175 a method for the production of NeuNAc is described in which microorganisms having a NeuNAc synthetase activity and bacteria, such as E. coli, capable of synthesizing phosphophenolic benzeneclonic acid are cultured in a medium in which N Acetyl-mannosamine and glucose or fructose is located. As an alternative to the aforementioned methods, EP 0 578 825 discloses a process for the preparation of NeuNAc-Bart. N-acetylglucosamine and pyruvic acid with N-acetylneuraminic acid lyase is reacted. The disadvantage of the methods described above is that they are mostly equilibrium reactions in which an excess of pyruvate must be used to postpone the equilibrium reaction to NeuNAc. Furthermore, the N-acetylglucosamine used in these reactions is too expensive to inexpensively produce NeuNAc. It is thus. Object of the present invention to provide a method which does not have the aforementioned disadvantages. # * I ♦ # ··· * * I · * «·» * ··· * * · I · · »**» The present invention relates to an isolated nucleic acid molecule comprising at least one promoter active in fungal cells, to each of which a nucleic acid sequence coding for an N-acetylglucosamine 2-epimerase and / or an N-acetylneuronic acid synthase is operatively linked, wherein the at least one in Fungal cells active promoter is a constitutive promoter. It has been found according to the invention that NeuNAc can be produced in a fungal cell in a simple and efficient manner, if this fungal cell is capable of constitutively expressing N-acetylglucosamin-2-epimerase and N-acetylneuraminic acid synthase. The felt tents used should also be able to provide sufficient N-acetyl-D-glucosamine to produce NA-cetyl-D-mannosamine using N-acetylglucosamine-2-epimerase, which can be synthesized using N-acetylneuraminic acid Synthase NeuNAc synthesized. Of course, it would also be possible to use fungal cells that are unable to provide N-acetyl-D-glucosamine. In such a case, N-acetyl-D-glucosamine would have to be added to the culture medium or organisms capable of delivering N-acetyl-D-glucosamine to the medium will be used. Since naturally occurring fungus cells are unable to express N-acetylglucosamine-2-epimerase and N-acetylneuraminic acid synthase, corresponding nucleic acid molecules comprising the corresponding nucleic acid sequences must be introduced into the fungal cells used. The nucleic acid molecule to be introduced can comprise the nucleic acid sequences of both enzymes. Alternatively, two nucleic acid molecules can also be introduced into the fungal cell, one molecule encoding N-acetylglucosamine 2-epimerase and one molecule of N-acetylneuraminic acid synthase. However, both molecules must be constitutively expressed in the host cell. In order to allow constitutive expression of the two enzymes, their coding nucleic acid sequences are operatively linked to a constitutively acting in fungal cells promoter. According to the invention, "operatively linked to it" means that the nucleotide sequence coding for the enzymes according to the invention is bound to the regulatory sequence (s) in such a way that the expression of the nucleotide sequence is possible and the two sequences are identical (4 * i · I | * · «» · * ** * * * ·· <are bound together in such a way that they fulfill the predicted function ascribed to the sequence.) A nucleic acid is "operatively linked" if it is in a Thus, a promoter is operatively linked to a coding sequence if it affects the transcription of the sequence, binding is achieved by ligation at convenient restriction sites, if such sites are not present then synthetic oligonucleotides are ligated. tadadaptoren used in accordance with conventional practice. A "constitutive promoter" is a promoter that allows a gene or operon to be continuously expressed in a cell. In contrast, the expression rate of genes or operons operatively linked to " inducible promoters " are tightly controlled, so that under certain conditions, the transcription is completely down-regulated and upregulated under other, preferably extrinsic, conditions. N-acetyl-D-glucosamine-2-epimerase or N-acetylglucosamine-2-epimerase (EC 5.1.3.8) catalyzes the reaction of N-acetyl-glucosamine to N-acetylmannosamine. The coding nucleic acid sequence of this enzyme is i.a. of mammals and bacteria, such as cyanobacteria, in which these enzymes exprinr. err. become. The corresponding coding nucleic acid sequences of these enzymes can be used according erfindunsgemäß. In order to improve the expression in fungal cells, it is possible to generate from an amnosauric sequence of the epimerase codon-optimized nucleic acid sequences which are finally used in the nucleic acid molecule according to the invention. It is particularly preferred that N-acetylglucosamine-2-epimerase from Anabaena sp. (GenBank AB-G57042) provided in the nucleic acid molecule according to the invention and to express in fungal cells. To improve the expression of the aforementioned enzymes, it is advantageous to optimize the nucleic acid sequences for their codon frequency in a host cell in which these e.i are introduced. Codon optimization was performed on the codon frequency information, for example, in Trichoderma reesei. This information can be obtained from the "Codon Usage Database". The codon usage of Trichoderma reseei is listed in Table 1. Table 1: Codon usage in Hypocrea jecorina (Trichoderma * * $ * # · · a «· *" ** · - 4 "- ** reseei), 2.3. based on the analysis of 118 CDS's (54050 co-dons) (Source: http://www.kazusa.or.jp/codon/cgi-bin/showco-don,cqi species=51453) Fields: [Triplet] [Frequency of occurrence per 1000] ([number]} uuu 13. 3 (71 9) ucu 10. .7 (580) UAU 8, 6 {463) UGU 3. .0 (1 64) do 24. 3 {1311) ucc 20. .4 ·; 1101) UAC 27,. 5 (1486) UGC IC. , 6! 575) ÜUA 0. • 7 (39) UCA 6, .4 (345) ÜAA 0. 9 (50) UGA 0,, 5 (29) UUG 7. 9 (428) UCG 16. 0 (866) UAG 0.. 7 (39) UGG 16. 7 (904) CUÜ 9. 4 (510) ccu 12. 3 (663) CAU 5. , 3 (285) CGU 5. 5 (295) cuc 29. 9 (1617) ccc 25. 4 (1 375) CAC 17. 7 (957) CGC 17. 4 (939) CUÄ 2,. 3 (125) CCA 6.9 (371) CAA 8. .7 (469) CGA 7. , 3 (394) CUG 27. , 3 (14 7 3) CCG 11. 9 (641) CAG 31. 9 (1725) CGG 5. 6 (300) AUU 16. .0 (866) ACU 10. 7 (578) AAU 8. 3 (447) AGU 3. .9 (213) AUC 31. , 0 (1 676) ACC 27. .2 (1 470) AAC 38..4 (2077) AGC 22. 2 (1202) AUA 2. 1 (115) ACA 7. , 5 (405) AAA 4. , 6 (250) AGA 2. 9 (158) AUG 20.. 1 (1085) ACG 18. 3 (987) AAG 42. .4 (2293) AGG 5.. 2 (279) GUU 11, .2 (608) GCU 18. , 0 (972) GAU 15. • 8 (854) GGU 1 4. , 0 (754) GUC 3 6. 9 (1992) GCC 48. .0 (2596) GAC 41. 0 (2214) GGC 51,, 0 (2758) GUA 2. .4 (131) GCA 10, .5 (566) GAA 10. .2 (551) GGA 13. .3 (720) GUG 1 4, 8 8 00) GCG 14, 2 (7 65) GAG 38. .0 (2052) GGG 7. .0 (37 8) N-acetylneuraminic acid synthase (EC 2.5.1.56) catalyzes the reaction of N-acetylmannosamine into NeuNAc. In this reaction, phosphoenolpyruvate and water are also converted as co-subtracts. N-acetylneuraminic acid synthase is expressed in bacteria such as E. coli, Campylobacter jejuni and Neisseria meningi Lidis. The corresponding nucleic acid and amino acid sequences are thus sufficiently known or identifiable. From the known sequences it is possible to derive codon-optimized nucleic acid sequences which are particularly well transcribed or translated into fungal cells. It is particularly preferred to provide N-A-cet.ylneuraminic acid synthase from Campylobacter jejuni (e.g., C. iejuni, NCTC11168) in the nucleic acid molecule of the invention and to express it in fungal cells. According to a particularly preferred embodiment of the present invention, the N-acetyl-D-glucosamine 2-epimerase encoded by the following nucleic acid sequence: atgggcaagaacctccaggccctggcccagctctacaagaacgccctcctcaacgacgtcctq-cccttctgggagaaccacagcctcgacagcgagggcqgctacttcacctgcctcgaccgc-cagggcaaggtctacgacaccgacaagttcatctggctccagaaccgccaggtctggacctt- • • ft · * c c (ca tgccctgcyaccagctggagaagcgcgagaactggctcaagatcgcccgcaacggcgc- caagttcctcgcccagcacggccgcgacgacgagggcaactggtactttgccctgacccgcgg- cggcgagcctctggtccagccctacaacatcttcagcgactgcttcgccgccatggcctt- cagccagtacgccctcgccagcggcgaggagtgggccaaggacgtcgccatgcaggcctacaa- caacgtcctccgccgcaaggacaaccccaagggcaagtacaccaagacctaccccggcacccg "ccccatgaaggccctggctgtccccatgatcctcgccaacctcaccctggagatggagtggct- cctcccccaggagaccctggagaacgtcctcgccgccaccgtccaggaggtcatgggcgactt" cctcgaccaggagcagggcctcatgtacgagaacgtcgcccccgacggcagccacatcgact- gcttcgagggccgcctcatcaaccccggccacggcatcgaggccatgtggttcatcatgga- catcgcccgccgcaagaacgacagcaagaccatcaa ccaggccgtcgacgtcgtcctcaacat- cctcaacttcgcctgggacaacgagtacggcggcctctactacttcatggacgccgccggc- caccccccccagcagctggagtgggaccagaagctctggtgggtccacctggagagcctcgt- cgccctcgccatgggctaccgcctcaccggccgcgacgcctgctgggcctggtatcagaagat- gcacgactacagctggcagcacttcgccgaccctgagtacggcgagtggttcggctacctcaa- ccgccgaggcgaggtcctcctcaacctcaagggcggcaagtggaagggctgcttccacgtccc- ccgcgccatgtacctctc / ctggcagcagttcgaggccctcagctaa According to a further preferred embodiment of the invention, the constricting vorlie N-acetylneuraminic acid synthase is encoded by the following nucleic acid sequence: atgcagatcaagatcgacaagctcaccatcagccagaagaaccccctcatcatcccccagat- cggcatcaaccacaacqgcagcctqgagatcgccaagctcatggtcgacgccgccaagcgage- cggcgccaagatcatcaagcaecagacccacatcgtcgaggacgagatgagccaggaggccaa- gaacgtcatccccggcaacgccaacatcagcatctacgagatcatggagcagtgcgccct- caactacaagaacgagctggccctcaaggagtacgtcgagaagcagggcctcgtctacct- cagcacccccttcagccgcqccgccgccaaccgcctggaggacatgggcgtcagcgcctacaa- gatcggcagcggcgag tgcaacaactaccccctgatcaagcacatcgcccagttcaagaagcc- catgatcatcagcaccggcatgaacagcatcgagagcatcaagcccaccgtcaagatcctccg- cgactacgagatccccttcatcctcctgcacaccaccaacctctaccccacccccagccacct- cgtccgcctccaggccatgctggagctgtacaaggagttcaactgcctctacggcclcagc- gaccacacgacgaacaacctcgcctgcatcggcgccatcgccctcggcgccagcgtcctggag- cgccacttcaccgacaocatggaccgcaagggccccgacatcgtctgcagcatggacgagag- caccci: caaggacctcatcaaccagacccaggagatggtcctcctccgcggcgace ) a caacaagaaccccctgaaggaggagcaggtcaccatcgacttcgcct tcgccagcgtcgtcagcat.- caaggacatcaagaagggcgagatcct cagcatggacaacatctgggtcaagcgccc- caqcaagggcggcatcagcgccaaggacttegaggccatcctcggcaagcgcgccaagaagga- catcaagaacaacatccagctcacctgggacgacttcgagtaa According to a preferred embodiment of the present Er I ·······························································································. The fungus lines of the genus Trichoderma belong to Fungal cells of the genus Trichoderma are particularly well suited for the biosynthesis of NeuNAc, since the members of this genus are able to provide sufficient N-acetyl-D-glucosamine available. According to a particularly preferred embodiment of the present invention, the fungal cells are Trichoderma reesei cells. According to a preferred embodiment of the present invention, the constitutive promoter is selected from the group consisting of promoters of the glycolysis genes, in particular pki, gpd or zwfl, tefla, act, cox4, negl and sarl. Another aspect of the present invention relates to a vector comprising a nucleic acid molecule according to the present invention. Yet another aspect of the present invention relates to a fungal cell comprising a nucleic acid molecule or a vector according to the present invention. One or more nucleic acid molecules or vectors comprising nucleic acid sequences coding for N-acetylglucosamine-2-epirerase and N-acetyl-neuraminic acid synthase can be introduced into the fungal cell according to the invention. The sections encoding the enzymes are operably linked to a constitutive promoter. The nucleic acid molecule according to the invention or the vector according to the invention are introduced into the host cell by generally known methods. According to a preferred embodiment of the present invention, the fungal cell belongs to the genus Trichoderma. Members of the genus Trichoderma are able to provide enough chelate N-acety 1.glucosamine in sufficient quantity to adequately NeuNAc with the aid of recombinant N-acetylglucosamine n-2-F. Purimerase and N Acetyl-neuraminic acid synthase synthesize. Therefore, according to the invention, fungal cells of this genus are used with particular preference. If chitin is used as the starting substance, this is broken down into N-acetyl glucosamine. This monomer can be used both as a carbon and as a nitrogen source for cell growth, as well as a building block for cell wall biosynthesis Ingredient is chitin) as well as be used for the synthesis of N-acetyl neuraminic acid. An inducible system starts at a point and thus overloads the availability of N-acetyl glucosamine. In contrast, N-acetyl glucosamine is continuously withdrawn through a constitutive system, allowing continuous product formation. According to a particularly preferred embodiment of the present invention, the fungal cell is Trichoderma reesei. The fungal cell according to the invention comprises at least one nucleic acid molecule whose nucleic acid sequence encodes an N-acetyl-glucosamine-2-epimerase and an N-acetylneuraminase synthase and is operatively linked to a constitutive promoter active in fungal cells. Another aspect of the present invention relates to a process for producing N-acetylneuraminic acid (NeuNAc) comprising culturing fungal cells according to the present invention in the presence of an N-acetyl-D-glucosamine source. To prepare NeuNAc with an N-acetylglucosamine 2-epimerase and an N-acetylneuraminic acid synthase, N-acetyl-1-D-glucosamine is needed as a substrate. Therefore, it is necessary to use fungal cells capable of providing this substrate. According to a preferred embodiment of the present invention, the N-acetyl-D-glucosamine source is chitin. The subject invention will be further illustrated by, but not limited to, the following figures and examples. Figure 1 gives an overview of the possible metabolic pathways starting from the polymer chitin to the formation of NeuNAc. Metabolic intermediates are shown in rectangles and arrows symbolize enzyme-catalyzed reactions. Next to the arrow is the corresponding EC number of the enzyme reaction. A circled plus indicates an enzyme reaction that could be assigned to a gene in the genome of Trichoderma reesei (http://qenome.jqipsf.orq/Trire2/Trire2.no-me.html). In the case of encircled minus can not annotated gene irr. currently published genome can be found. FIG. 2 shows the formation of NeuNAc in an in vitro reaction with heterologously expressed T. reesei protein in the transgenic strain PEC / PSC1 using the substrates GlcNAc, ATP and ΨΨ * · · · · * * * * · ·t 8-pf p. (a) The extracted ion chromatograms (EIC) of a HPLC-MS analysis at a mass of 222,098 atomic mass units (amu) are shown. This mass corresponds to the mass of the [GlcNAc + H] + ion as well as that of the [ManNAc + H] + ion. The retention time (RZ) of GlcNAc (12.988 min) and ManNAc (12.288) were determined with pure standards of both substances and this is indicated by a vertical line in the chromatogram. (1) Chromatogram of in vitro enzyme reaction with GST fusion proteins of GlcNAc-2-epimerase and NeuNAc synthase expressed in E. coli. (2) Chromatogram of the enzyme reaction with the cell-free extract of the transgenic PEC / PSC1 strain. (3) Chromatogram of the reaction with the cell-free extract of the parent strain QM9414 as a negative control. (b) The EICs at a mass of 310.1134 amu are shown to match the mass of the [NeuNAC + H] + ion and can be detected at a retention time of 8.345 min. In the case of chromatogram (1), (2) or (3) are the same samples as described under point (a), wherein chromatogram (2) compared to chromatogram (1) by 10 times and chromatogram (3) amplified 1000 times. (ad 1) Contains the mass spectrum to chromatogram (1) at the retention time of 8.345 min. (ad 2) Shows the mass spectrum of chromatogram (2) at the retention time of 8.348 min. Fig. 3 shows the formation of NeuNAc in vivo in T. reesei in the transgenic strain PEC / PSC1 after culturing on GlcNAc for 66 h. (a) The FICs of the HPLC-MS analysis at a mass of 222,097 amu are shown ([GlcNAc + H] t ion and [ManNAc + H] + ion). The retention time (RZ) of GlcNAc (12.988 min) and ManNAc (12,288) were determined with pure standards of both substances, and this is indicated by a vertical line in the chromatogram. (1) Chromatogram of in vitro enzyme reaction with GST fusion proteins of GlcNAc-2 epi. Merase and NeuNAc synthase expressed in E. coli. (2) Chromatogram of the cell-free extract of the transgenic PEC / PSC1 strain. (3) Chromatogram of the cell-free extract of the parent strain QM9414 as a negative control. (b) The EICs at a mass of 310.1134 amu are shown, which correspond to the mass of the [NeuNAC + H] + ion and are detected at a retention time of 8.345 mm. In the case of chromatogram (1), (2) and (3) are the same samples as described under point (a), wherein chromatogram (2) over chromatogram (1) by 100 times and chromatogram (3) amplified 1000 times, (ad 1) Contains the mass spectrum for chromatogram (1) at the retention time of 8.345 min. (ad 2) Shows the mass spectrum of chromatogram (2) at the retention time of 8.348 min. EXAMPLE: Materials and methods Strains and cultivation conditions Trichoderma reesei (Hypocrea jecorina) QM9414 (ATCC 26921) was used as the starting strain in this example and was cultivated on malt extract agar. Mycelia for the in vitro enzyme reactions were obtained from cultivations of the strains in 1000 mL Erlenmeyer flasks with 200 mL 3% (w / v) malt extract medium each. The bottles were inoculated with 10A8 conidia per liter and culturing was done at 30 ° C and 250 rpm for 40 h. Cultivation of T. reesei on colloidal chitin was performed in 1000 mL Erlenmeyer flasks containing 200 mL almond Andreotti medium containing 1% (w / v) colloidal chitin and 0.1% (w / v) Bacto peptone. The inoculation was carried out with 10Λ8 conidia per liter and the incubation was carried out at 30 ° C / 250 rpm for 90 h. For the in vivo production of NeuNAc, the respective T. reesei strains were cultured directly in 250 mL Mandeis Andreotti medium with 1% (w / v) GlcNAc at 30 ° C. and 250 rpm for 66 h (inoculation with 10A8 spores / liter ). Synthetic genes and plasmid construction The synthetic gene tbage was determined by the protein sequence of Anabaena sp. CHI GicNAc-2-epimerase (GenBank: ABG57042) was generated by translating the protein sequence into a DNA sequence using the software GeneOptimizer © (Geneart, Germany). Here, the DNA sequence was optimized in terms of codon usage of T. reesei (Table 1): > tbage tctaqaatgqqcaaqaacct ccaaaccetqqcccaactctacaaaaacqccctcctcaac-gacgtcctgcccttctgggagaaccacagcctcgacagcgagggcggctacttcacctgcctc-gaccgccagggcaaggtctacgacaccgacaagttcatctggctccagaacogc-caggtctggaccttcagcatgctctgcaaccagctggagaagcgcgagaactggctcaagat- · * · "·" · «« I • ** "* # *" * cgcccqcaacggcgccaagttcctcgcccagcacggccgcgacgacgagggcaactgg- tactttgccctgacccgcggcggcgagcctctggtccagccctacaacatcttcagcgact- gcttcgccgccatggccttcagccagtacgccctcgccagcggcgaggagtgggccaag- gacgtcgccatgcaggcctacaacaacgtcctccgccgcaaggacaaccccaagggcaagta- caccaagacctaccccggcacccgccccatgaaggccctggctgtccccatgatoctcgccaa- cctcaccctggagatggagtggctcctcccccaggagaccctggagaacgtcctcgccgccac- cgtccaggaggtcatgggcgacttcctcgaccaggagcagggcctcatgtacgagaacgtcgc- ccccgacggcagccacatcgactgcttcgagggccgcctcatcaaccccggccacggcatc- gaggccatgtggttcatcatggacatcgcccgccgcaagaacgacagcaagacoatcaac- caggccgtcgacgtcgtcctcaacatcctcaacttcgcctgggacaacgagtacggcggcctc- tactacttcatggacgccgccggocaccccccccagcagctggagtgggacca- gaagctctggtgggtccacctggagagcctcgtcgccctcgccatgggctaccgcctcaccgg- ccgcgacgcctgctgggcctggtatcagaagatgcacgactacagctggcagcacttcgcc- gaccctgagtacggcgagtggttcggctacctcaaccgccgaggcgaggtcctcctcaacct- caagggcggcaagtggaagggctgcttccacgtcccccgcgccatgtacctctgctgg- caqcaattcaaaaccctoaactaatQcat In an analogous procedure, the synthetic gene tneub was generated, which is based on the protein sequence of the NeuNAc synthase of Campylo-bacterium jejuni NCTC11168 (http: //old.qenedb.orq/qenedb/cj ei uni / Index. I sp, Cjll41) and its DNA sequence has also been adapted to the codon usage of T. reesei: > tneub tctaqaatqcaqa tcaaqat.cgacaagc tcacca LcagccagaagaaccccctcatcaLcccc- gagatcggcatcaaccacaacggcagcctggagatcgccaagctcatggtcgacgccgccaag- cgagccggcqccaagatcatcaagcaccagacccacatcgtcgaggacgagatgagccaggag- gccaagaaegtcatccccggcaacgccaacatcagcatctacgagatcatggagcagtgcgc- cctcaactacaaggacgagctggccctcaaggagtacgtcgagaagcagggcctcgtctacct- cagcacccccttcagccgcgccgccgccaaccgcctggaggacatgggcgtcagcgcctacaa- gatcggcagcggcgagtgcaacaactaccccctgatcaagcacatcgcccagttcaagaagcc- catgatcatcagcaccggcatgaacagcatcgagaqcatcaagcccaccgtcaagatcctccg- cgactacgagatccccttcgtcctcctgcacaccaccaacctctaccccacccccagccacot- cgtccgcctccaggccatgctggagctglacaaggagttcaactgcctcLacggcctcagc- gaccacacgacgaacaacctcgcctgcat cggcqccalcgccctcggcgccagcgtcctggag- cgccacttcaccgacaccatggaccgcaagggccccgacatcgtctgcagcatggacgagag- caccclcaaggacctcatcaaccagacccaggagatggtcctcct. ccgcggcgacaacaacaa- gaaccccctgaaggaggagcaggtcaccatcgacttcgccttcgccagcgtcgtcagcat- caaggacatcaagaagggcgagatcctcagcatggacaacatctggg tcaagcgccc- «···» t ·· · · · «· * Λ« · * * * «* - 11 - cagcaagggcggcatcagcgccaaggacttogaggooa Lcct cggcaagcgcgccaagaagga-r.atcaaaaacaacatccaactcacctaaaacaacttcqaqtaatqcat For the construction of plasmids ρΜΞ-PEC and pMS-PSC, the synthetic genes tbage and tneub were excised from their production plasmid by XbaI / Nsil restriction digestion and transformed into the plasmid pRLMex30 (Mach, R.L. et al., 1994. Curr Genet 25: 567-70), where the hph gene between the Xbal and Nsil cleavage sites has been replaced by tbub and tneub, respectively. For the construction of pGEX-epi and pGEX-syn, the plasmid pGEX4T-2 (GE Healthcare, UK) was digested with EcoRI and Xhol. A double-stranded DNA consisting of the oligomeric nucleotides GEXfw and GEXrev (Table 1) was inserted into the open pGEX4T-2 resulting in the plasmid pGEX-MS and the new Xbal and Nsil cleavage sites were generated, tbage and tneub were in pGEX-MS introduced via the interfaces Xbal / Nsil whereupon the plasmids pGEX-epi and pGEX-syn emerged. Table 2; NukleoLidsequenzen the Oligome re used Name Sequence (5 > 3) using NANASfw GTGGTGTGCAGGAGGACGAA qPCR tneub NANASrev CAAGCACATCGCCCAGTTCAAG qPCR tneub ManEfw GCGATCTTGAGCCAGTTCTC qPCR tbage ManErev GCTACT'J'CACCTGCCTCGAC qPCR tbage GEX-MSFW AATTCCTTCTAGAGATATGCATC construction of pGEX-MS GEX-MSrev TCGAGATGCATATCTCTAGAAGG construction of pGEX -MS pkifw R CTGCGACACTCAGAACATGTACGT qPCR pkl cDNA pkifw D GCTCTGCTTGGAACCTGATTGA qPCR pki pki DNA pkirev GGTCTGGTCGTCCTTGATGCT qPCR sarlfw TGGATCGTCAACTGGTTCTACGA qPCR sar 1 sar1rev GCATGTGTAGCAACGTGGTCTTT qPCR sar 1 protoplast transformation of T. reesei The Protop1astentransformation before t. reesei was used as in an earlier article (Gruber, F., et al., 1990. Curr Genet. 18, 71-6) mentioned above. A total of 10 pg DNA was used per transformation. In a cotransformation, pMS-PEC (4 pg) and pMS-PSC (4 pg) were transformed together with the piasin pHylox2 (2 μς), which mediates hygromycin B resistance. Recombinant strains were selected for hygromycin B resistance. RNA analysis RNA extraction, reverse transcription and qPCR were performed as described in an earlier article. Oligomeric nucleotide sequences which were used as primers are listed in Table 1. Sari was used as reference gene for the normalization of RT-qPCR. For the tbage gene, the primers ManEfw and ManErev were used in the qPCR at an optimal elongation temperature of 64 ° C. and 2 mM MgC12. For the tneub gene, primers NANAfw and NANArev were used in the qPCR at an optimal elongation temperature of 64 ° C. For the pki gene, primers pkifwR and pkirev were used in the qPCR at an optimal elongation temperature of 64 ° C. Data analysis was performed with REST 2008. DNA analysis Genomic DNA was isolated from the fungal mycelium as described in a previous article. Hybridization and detection was performed according to standard procedures with the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, Switzerland). QPCR. genomic DNA was performed with -b0.g genomic template DNA. The same primers as in the RNA analysis were used for the genes tbage and tneub. The reference gene used was pki, which was decorated with the primers pkifwD and pkirev at an elongation temperature of 64 ° C. ampl i i "i. Glutathione S-Transferase (GST) Fusion Proteins GST fusion proteins of GlcNAc-2-epimerase (GSTrepi) and NeuNAc-Santhase (GST: syn) were isolated by expression of plasmids pGEX-epi and pGEX-syn in E. coli BL21 (DE3) cells generated. Purification of the fusion proteins was performed using GSTrap "FF Column 1: nL Column Volume (GE Healthcare), using the standard protocol. Enzyme reaction with cell-free extracts Harvested mycelium was ground to a fine buffer in liquid nitrogen and then resuspended in a 0.1 M Bicine buffer (pH 8) containing protease inhibitors (2 μΜ leupeptin, 1 μΜ pepstatin A, 10 μΜ RMSF) (0.3 g mycelial powder / 1 mL Buffer). The suspension was further disrupted using a Soni-fier © 250 Cell Disruptor (Branson, US) ultrasonic wand (settings: power 40%, duty oycie 50%, 20 s action, 40 s pause, 10 cycles) and insolubles by centrifugation (10 min, 13000 xg, 4 ° C). The supernatant was used in one for the enzymatic reaction. The enzyme reaction was carried out similarly as described by Vann et al. (Vann, W.F., et al., 1997. Glycobiology 7: 697-701). The reaction to detect the activity of GlcNAc-2-epimerase includes 10 mM GlcNAc, 0.2 mM ATP, 100 mM Bicine buffer (pH 8) and 10-40 pL cell-free extract in a total volume of 100 pL. The reaction to detect the activity of NeuNAc synthase includes 10mM ManNAc, 10mM PEP, 12.5mM MnC12, 100mM bicine buffer (pH 8) and 10-40pL cell-free extract in a total volume of 100pL. The combination reaction to detect both the activity of GlcNAc-2-epimerase and NeuNAc synthase includes 10mM GlcNAc, 10mM PEP, 12.5mM MnCl2, 100mM bicine buffer (pH 8) and 40pL cell-free extract in a total volume of 100pL , All reactions were incubated for 60 min at 37 ° C, inactivated by heating to 85 ° C for 10 min and then analyzed by HPLC. As a positive control, 5 pL (1 pg / pL) of the GST fusion proteins GST: epi and GST: syn were used in the enzyme reaction instead of the cell-free extracts. Chitinase enzyme reaction The release of GlcNAc from the polymer chitin is measured in this reaction. The chitin was used both as Rohchitin from shrimp tanks and as colloidal chitin in a 30 mM Phosohatouffer (pH 4.7). 5, 10 or 50 pL of culture supernatant were measured in a total volume of 1.5 mL. The reaction was incubated at 37 ° C for 20 h and then inactivated by heating at 90 ° C for 10 min. The formation of GlcNAc was measured by HPLC. NeuNAc detection in cell-free extracts Harvested mycelium from T. reesei was ground to a fine powder in liquid nitrogen and resuspended in bidistilled water (0.3 g mycelial powder / 1 mL water). The suspension was further digested with a Sonifier® 250 Cell Disrupeor (Branson, US) sonic wand (settings: power 40%, duty cycle 50%, 20 sec action, 40 sec rest, 10 cycles) and insolubles by centrifugation (10 min, 13000 xg, 4 ° C) separated. The supernatant was filtered through a 0.45 pm filter and analyzed by HPLC-MS. • ·% - 14 HPLC-MS analysis The formation of NeuNAc and ManNAc in the enzyme reaction as well as in the cell-free extract was determined on a HPLC-MS (IT-TOF-MS) (Shi-madzu, Japan) with a Rezex ™ RHM Monosaccharide H + column (8%, 300 x 7.8 mm ) (Phenomenex, USA). The mobile phase was water containing 0.1% (v / v) trifluoroacetic acid and the flow was set at 0.6 mL / min. The column temperature was 80 ° C and 10 pL of sample was applied to the column. Detection was in ESI + mode and a scan range of 60-600 amu was covered. Results In silico Analysis of a NeuNAc biosynthetic pathway in T. reesei There is currently no evidence in the current literature that NeuNAc can be naturally produced in Trichoderma reesei. Therefore, the known metabolic reactions that lead to the formation of NeuNAc and whether these occur in T. reesei were examined in silico. Figure 1 shows the currently known enzyme-catalyzed processes leading to the formation of NeuNAc using the biopolymer chitin as starting material. Trichoderma contains enzymes necessary for chitin catabolism. The first step of chitin to the monomer GicNAc is catalyzed by chitinases (3, 3, 1, 14). 'Furthermore, the activity of a hexokinase (EC 2.7.1.1), a GlcNAc-6-phosphate deazetylase (EC 3.3 .1.25) and a glucosamine-6-phosphate deairinase (EC 3.5.99.6), so that finally! Fructose-6-phosohaf can enter glycolysis. At least one potential enzyme in the annotated genome can be found in T. reosei for these enzyme activities (Table 3). In addition, genes responsible for the biosynthesis of chitin can be found, including a phosphoazetylglucosamine mutase (KC 5.4.2.3), a UDP-N-GlcNAc diphosphorylase (EC 2.7.7.23), and several chiral synthases (FC 2.4. 1.16). However, there are no genes annotated in the T. resse.i genome for the synthesis of ManNAc {FC 5.1.3.8 in bacteria, EC 5.1.3.4 in mammals) or for the synthesis of NeuNAc (EC 2.5.1.6. In bacteria Responsible, EC 2.7.1.60, EC 2.5.1.57, EC 3.1.3.29 in mammals). Table 3: Gene candidates for the metabolic reactions of chitin and GicNAc annotated in the genome of T. reesei. 15 EC Number Name Protein Identity 2735, 43873, 53949, 62645, 62704, 66041, EC 3.2.1.14 Chitinase 68347, 72339, 80833, 81598, 104401, 110317, 119859, 123354, 124043 EC 2.7.1.1 Hexokinase 56129, 73665, 79677 EC 3.5.1.25 GlcNAc-6-phosphate deazetylase 79671 EC 3.5.99.6 glucosamine 6-phosphate deaminase 49898 EC 5.4.2.3 phosphoacetylglucosamine mutase 80994 EC 2.7.7.23 UDP-N-GlcNAc diphosphorylase 79568 EC 2.4.1.16 chitm synthase 51492, 71563, 55341, 58188, 112271, 122172 A gene cluster for the catalytic conversion of GlcNAc into Trichoderma reesei During the in silico analysis of the degradation pathways for GlcNAc, 3 gene candidates (estExt GeneWisePlus.C 140427, estExt GeneWisePlus.C_140421, estExt_Genewisel.C_1.4 04 32) encoding a hexokinase, a GlcNAc-6-phosphate deazetylase and a glucosamine-6-phosphate deaminase are found, all of which are found in close proximity in the genome of T. reesei (location in the genome on "scaffold 14": 714385-729984). Similar clusters also exist in other fungal fungi, such as Neurospo-crassa or Aspergillus nidulans, indicating a conserved cluster for the catabolism of GlcNAc. The hexokinase (protein ID 79677), which is annotated in the genome of T. reese, can therefore further be specified as GicNAc kinase (EC 2.7.1.59), analogous to the annotation and characterization as it is found in Candida albicans (39 ). Furthermore, the gene (estExt_GeneWisePlus.C 140419) which is adjacent to the GlcNAc-6-phosphate deazetylase (estExt_GeneWisePlus.C_140421) may also belong to the cluster, since a homologue of this gene in Neurospora crassa as ß-N-acetylglucosaminidase (N. crassa OR74A (NC10): Supercontig 6: 560844-564980). Construction of expression vectors A two enzyme strategy was chosen for the production of NeuNAc in Trichoderma, the first enzyme step being catalyzed by one GicNAc 2 epimerase (EC 5.1.3.8) and the second by a NeuNAc synthase (EC 2.5.1.99). As a candidate, the protein sequence of the GicNAc 2 ~ Epime.rase from Anabaena sp. CHI (GenBank: ABG57042) and, for NeuNAc synthase, the protein sequence from Campylobacter jejuni NCTC11168 (Cj1141). The protein sequences were translated into DNA sequences using the GeneOptimizer® software (gene type) and the codon usage was adapted to that of T. reesei (Table 1). The resulting synthetic genes were called tbage and tneub. The coding sequences were inserted into the plasmid pRLMex30, replacing the coding sequence for the hph gene from this plasmid. Thus, both genes were under the control of the constitutive pki promoter and the cbh2 terminator (plasmids pMS-PEC m.i t tbage and p.MS-PSC rn i t tneub). To be able to express both genes under an inducible system, the pki promoter was replaced by the xyn1 promoter (plasmids pMS-XEX with tbage, and pMS-XSC with tneub). Table 4: Comparison of an inducible promoter system (xynl) versus a constitutive promoter system (pki) (n.b. not determined, + present, - not present) 1 / Promoter DNA in the genome transcript formation enzyme activity strain Epi- Syn- Epi- Syn- Epi- Syn- merase thase merase thase merase thase XEX5 xynl + n.b. + n.b. - n.b. XEX11 xynl + n.b. + n.b. - n.b. XSC3 xynl n. B. f n.b. + n.b. - XSC13 xynl n. B. t n.b. + n.b. - PECH pki + n.b. + n.b. + n.b. PEC15 pki + n.b. + n.b. + n.b. PEC17 pki + n.b. + n.b. + n.b. PSC15 pki n.b. + n.b. + n.b. + PSC16 pki n.b. + n.b. b n.b. + PSC17 pki n.b. + n.b. + n.b. - XEX / XSC1 xynl + + + + - XEX / XSC5 xynl + + + - - PEC / PSC1 pki + + + + + + PEC / PSC10 pki + + + + + - To produce Trichoderma reesei strains capable of producing NeuNAc, the parent strain QM9414 was probed with various combinations of the plasmids pMS-PEC, pMS-PSC, pMS-XEX and pMS-XSC and pMS-Hyiox2 (containing the selection marker hph between two loxP Sequences). The plasmids containing the genes tbage and tneub were transformed both individually and in combination with Lneub / tbage. Selected transformants were examined for the integration of the transformed DNA into the genome and their transcript formation and enzyme activity of GlcNAc 2-epimerase and NeuNAc syn-thase. The results are shown in Table 4. It can be seen that while the xynl promoter can detect transcription, no enzyme activity of the bulges heteroiogically expressed enzymes was detectable. It was therefore only with the strains that expremierten the two genes under the control of pki promoter continued. The be.i.den strains PEC / PSC1 and PEC / PSC10 were further tested for their genemic copy number ratio of tbage and tneub. Table 5 shows the results of this study. Table 5: Comparison of gene transcription and gene copy number between 2 transgenic T. reesei strains Transcript Ratio Copy Ratio Gene Designation PEC / PSCI / PEC / PSC10 PEC / PSCI / PEC / PSCl0 Median [95% CI] Median [95% KX] tbage 2.021 [1.589-2.836] 1.810 [1.376-2.585] tneub 0.479 [0.385-0.622] 0.400 [0320 to 0492] The PEC / PSCl strain shows about 2-fold higher transcription of the tbage gene than the PEC / PSC10 strain. In contrast, the PEC / PSC10 strain has about two-fold higher transcription of the tneub gene than the PEC / PSC1 strain. These different transcript levels can be explained by the different copy numbers of the two genes in the genome of the two strains. The ratio of copy number in the two strains was measured by qPCR of genomic DNA, using as a reference the gene coding for pyruvate kinase (pki). The copy ratios in the two strains behaved in the same way as the transcript ratios, so that the different ratios of transcripts can be explained by the copy number ratio and each copy of the gene is apparently transcribed with the same efficiency (Table 5). Heterologous protein expression of GlcNAc 2-epimerase and NeuNAc synthase in Trichoderma reese After cultivating the Trichoderma reesei strain, the cell-free extract was tested for the presence of GicNac 2-epimerase and NeuNAc synthase. The reaction of the substrates PEP uro GlcNAc ManNAc and NeuNAc was measured after addition of the enzyme-containing cell-free extract. The reaction was analyzed by HPLC-MS and the corresponding chromatograms are shown in Figure 2. As a PosiLiv control GST fusion proteins of GlcNAc 2-epimerase (tbage) and NeuNAc synthase (tneub), which were generated by expression in E. coli, were used in the implementation. The formation of ManNAc and NeuNAc shows that the two synthetic genes tbage and tneub are functionally expressed in Trichoderma (Figures 2a2 and 2b2). Likewise, the post iv control shows. For the GST fusion proteins, the formation of ManNAc and NeuNAc (Figures 2al and 2bl). But neither ManNAc nor NeuNAc are formed in the enzyme reaction when an extract from the parent strain QM9414 is used. This result shows that no significant GlcNAc 2-epimerase activity is present in the parent strain. In addition, the pure NeuNAc synthase activity in strain QM9414 was also tested by using ManNAc and PEP as substrate in the enzyme reaction. However, even in this case no activity could be detected in the parent strain, suggesting that there is no NeuNAc synthase nor GlcNAc 2-epimerase activity in natural isolates of Trichoderma reesei. Growth of Trichoderma reesei on colloidal chitin and release of GlcNAc To study the hydrolysis of chitin into the monomer GlcNAc, we cultivated T. reesei PEC / PSCl on colloidal chitin as a carbon source. During cultivation, the increase in chitinase activity was monitored. After 90 h of culture, chitinase activity reached a maximum and the supernatant was tested for the ability to hydrolyze chitin. Table 6 presents the results. Ten times more GlcNAc can be released from colloidal crab armor chitin than from untreated crab armor chitin. Released GlcNAc can be used as starting material for the production of NeuNAc with strain PEC / PSC1. Table 6: Chitinase activity produced by cultivating T. reesei PEC / PSCl strain, to 1% chitin. substratum Chitinase activity [mU / mL] 2.7 ± 0.5 25.0 ± 0.9 he ab-sheil chit-in colloid. crab-shell chitin a 1U: release of Igmol GlcNac / min at 37 ° C In vivo formation of NeuNAc in T. reesei In the following experiment, it should be clarified whether the 2 hete-rolog expressed enzymes are also functional in vivo and have the ability to form NeuNAc from their nutrient substrate. For this, the recombinant strain PEC / PSC1 was cultivated on GlcNAc. As a negative control, the parent strain QM9414 was cultured. From both strains, the mycelium was harvested and assayed for the presence of NeuNAc by HPLC-MS. The results are shown in Figure 3. The recombinant strain PEC / PSC1 forms ManNAc (Figure 3a2) and NeuNAc (Figure 3b2, 10 pg per g dry biomass). This result demonstrates that NeuNAc can be produced in T. reesei by coexpressing two bacterial enzymes. The parent strain QM9414 shows no formation of NeuNAc nor ManNAc (Figs. 3a3 and 3b3). summary of results In this example, the introduction of an intracellular synthetic route for the production of NeuNAc in the fungus Trichoderma reesei has been demonstrated. To the best of our knowledge, this is the first work in which an intracellular two-step enzyme cascade is introduced into a filamentous fungus to produce a fine chemical such as NeuNAc , T. reesei itself is not able to produce NeuNAc, but the important intermediate metabolite GlcNAc is produced by T. reesei. This substance is released during the depolymerization of the renewable raw material chitin (Table 6). Due to its saprophytic lifestyle, T. reesei produces a variety of chitinases (Table 3) and can effectively decompose the polymer chitin into its monomer GlcNAc. The specific biosynthesis of NeuNAc starts from intermediates of the chitin pathway (GlcNAc and UD-P-GlcNAc, respectively) (see Fig. 1), which are available in T. reesei, but no genes can be found in this organism which a similarity to genes coding for a UD-P-GlcNAc-2-epimerase, a ManNAc kinase, a NeuNAc-9-phosphate synthesis nor a NeuNAc-9-phosphatase An alternative synthetic route for NeuNAc, as it degenerates into bacteria needed the activity of a GicNAc-2-F. pimerase and a NeuNAo-Syrvthase (Figure 1). Again, there are no genes in Trichoderma reeesei for this pathway. In Aspergillus fumigates the presence is present. NeuNAc was detected on the surface of conidia, but no NeuNAc could be found on the conidia of Trichoderma reesei strain QM9414. Neither the necessary enzyme activity nor traces * φ ♦ ··· # ···················································································. - * 21 ** - ** from ManNAc and NeuNAc Could be measured in this strain. This shows that Trichoderma reesei strains can not naturally produce either NeuNAc or ManNAc. Therefore, it is necessary to generate the corresponding enzyme activities by heterologous expression in this organism to produce NeuNAc. The first enzyme in the cascade, a G.lcNAc 2-epimerase, was isolated from Anabaena sp. taken. This enzyme is well characterized and requires a comparatively small amount of the cofactor ATP (20μΜ) to maximize its activity. The second enzyme, a NeuNAc synthase, was chosen from C. jejuni. The codon usage of both genes was optimized for the codon usage of Trichoderma reesei to improve the expression of bacterial genes in the fungal host. On the one hand, the constitutive promoter of the pki gene and the well-regulated promoter of the xynl gene were selected for the expression of the genes. Under the control of the xynl promoter, no successful expression of the two genes could be achieved. Although it could be shown that the genes are transcribed, no enzyme activity could be detected. However, under the control of the pki promoter, the two heterologously expressed genes can not only be transcribed, but also the corresponding complement of enzyme activity could be detected, in a strain expressing both genes under the constitutive pki promoter. premier, the formation of NeuNAc could also be shown in vivo. For this purpose, the fungus was cultured on Biopoiymer chitin, which led to the release of the monomer GlcNAc. Boi cultivation of the recombinant strain revealed the formation of NeuNAc in the mycelium (Fig. 3b2). By introducing a two-step enzyme cascade into Trichoderma reesei, it has been shown that the fungus has the ability to produce NeuNAc. This example shows that high-quality cocoa can be produced from a renewable raw material, such as chitin. But not only Ch.it 1 n but a variety of other carbon sources, such as Zei ..uiose and liemizel lu; eson, can be exploited by the saprophyti see mushroom Trichoderma reesei and underline its potential to be used as a cell factory for the production of various chemicals. * r57503-2010-12-22-seq_list_ST25.txt SEQUENCE LISTING ≪ 110 > TECHNICAL UNIVERSITY OF VIENNA < 120 > method and means for producing N-acetylneuraminic acid (NeuNAc) < 130 > R 57503 < 160 > 15 < 170 > Patent version 3.5 < 210 > 1 < 211 > 1167 ≪ 212 > DNA < 213 > Artificial sequence < 220 > ≪ 223 > N-acetyl-D-glucosamine 2-epimerase < 400 > 1 atgggcaaga acctccaggc cctggcccag ctctacaaga acgccctcct caacgacgtc 60 ctgcccttct gggagaacca cagcctcgac agcgagggcg gctacttcac ctgcctcgac 120 cgccagggca aggtctacga caccgacaag ttcatctggc tccagaaccg ccaggtctgg 180 acettcagca tgctctgcaa ccagctggag aagcgcgaga actggctcaa gatcgcccgc 240 aacggcgcca agttcctcgc ccagcacggc cgcgacgacg agggcaactg gtactttgcc 300 ctgacccgcg gcggcgagcc tctggtccag ccctacaaca tcttcagcga ctgcttcgcc 360 gccatggcct tcagccagta cgccctcgcc agcggcgagg agtgggccaa ggacgtcgcc 420 atgcaggcct acaacaacgt cctccgccgc aaggacaacc ccaagggcaa gtacaccaag 480 acctaccccg gcacccgccc catgaaggcc ctggctgtcc ccatgatcct cgccaacctc 540 accctggaga tggagtggct cctcccccag gagaccctgg agaacgtcct cgccgccacc 600 gtccaggagg tcatgggcga cttcctcgac caggagcagg gcctcatgta cgagaacgtc 660 gcccccgacg gcagccacat cgactgcttc gagggccgcc tcatcaaccc cggccacggc 720 atcgaggcca tgtggttcat catggacatc gcccgccgca agaacgacag caagaccatc 780 aaccaggccg tcgacgtcgt cctcaacatc ctcaacttcg cctgggacaa cgagtacggc ggcct 840 ctact acttcatgga cgccgccggc cacccccccc agcagctgga gtgggaccag 900 aagctctggt gggtccacct ggagagcctc gtcgccctcg ccatgggcta ccgcctcacc ggccgcgacg cctgctgggc ctggtatcag aagatgcacg actacagctg gcagcacttc gccgaccctg agtacggcga gtggttcggc tacctcaacc gccgaggcga ggtcctcctc 1080 aacctcaagg gcggcaagtg gaagggctgc ttccacgtcc cccgcgccat gtacctctgc tggcagcagt tcgaggccct lt cagctaa 1167 & 1020 960 1140; 210 > 2 < 211 > 1032 ≪ 212 > DNA < 213 > Artificial sequence Page "ST25.txt < 220 > ≪ 223 > N-acetylneuraminic acid synthase < 400 > 2 atgcagatca agatcgacaa gctcaccatc agccagaaga accccctcat catccccgag 60 atcggcatca accacaacgg cagcctggag atcgccaagc tcatggtcga cgccgccaag 120 cgagccggcg ccaagatcat caagcaccag acccacatcg tcgaggacga gatgagccag 180 gaggccaaga acgtcatccc cggcaacgcc aacatcagca tctacgagat catggagcag 240 tgcgccctca actacaagga cgagctggcc ctcaaggagt acgtcgagaa gcagggcctc 300 gtctacctca gcaccccctt cagccgcgcc gccgccaacc gcctggagga catgggcgtc 360 agcgcctaca agatcggcag cggcgagtgc aacaactacc ccctgatcaa gcacatcgcc 420 cagttcaaga agcccatgat catcagcacc ggcatgaaca gcatcgagag catcaagccc 480 accgtcaaga tcctccgcga ctacgagatc cccttcgtcc tcctgcacac caccaacctc 540 taccccaccc ccagccacct cgtccgcctc caggccatgc tggagctgta caaggagttc 600 aactgcctct acggcctcag cgaccacacg acgaacaacc tcgcctgcat cggcgccatc 660 gccctcggcg ccagcgtcct ggagcgccac ttcaccgaca ccatggaccg caagggcccc 720 gacatcgtct gcagcatgga cgagagcacc ctcaaggacc tcatcaacca gacccaggag 780 atggtcctcc tccgcggcga caacaacaag aaccccctga aggaggagca ggtcaccatc 840 gactt cgcct tcgccagcgt cgtcagcatc aaggacatca agaagggcga gatcctcagc 900 atggacaaca tctgggtcaa gcgccccagc aagggcggca tcagcgccaa ggacttcgag 960 gccatcctcg gcaagcgcgc caagaaggac atcaagaaca acatccagct cacctgggac 1020 gacttcgagt aa 1032 < 210 > 3 < 211 > 1178 < 212 > DNA < 213 > Artificial Sequence < 220 > ≪ 223 > N-acetyl-D-glucosamine 2-epimerase < 400 > 3 tctagaatgg gcaagaacct ccaggccctg gcccagctct acaagaacgc cctcctcaac 60 gacgtcctgc ccttctggga gaaccacagc ctcgacagcg agggcggcta cttcacctgc 120 ctcgaccgcc agggcaaggt ctacgacacc gacaagttca tctggctcca gaaccgccag 180 gtctggacct tcagcatgct ctgcaaccag ctggagaagc gcgagaactg gctcaagatc 240 gcccgcaacg gcgccaagtt cctcgcccag cacggccgcg acgacgaggg caactggtac 300 tttgccctga cccgcggcgg cgagcctctg gtccagccct acaacatctt cagcgactgc 360 ttcgccgcca tggccttcag ccagtacgcc ctcgccagcg gcgaggagtg ggccaaggac 420 gtcgccatgc aggcctacaa caacgtcctc cgccgcaagg acaaccccaa gggcaagtac 480 accaagacct accccggcac ccgccccatg aaggccctgg ctgtccccat gatcctcgcc 540 * I ··· # ♦ · ··· Λ ♦ • · «« * * · • φ · ···· * «··· · · ♦ · ················································································································································································································································································································································································································································································································································································································ 20 cacggcatcg aggccatgtg gttcatcatg gacatcgccc gccgcaagaa cgacagcaag 780 accatcaacc aggccgtcga cgtcgtcctc aacatcctca acttcgcctg ggacaacgag 840 tacggcggcc tctactactt catggacgcc gccggccacc ccccccagca gctggagtgg 900 gaccagaagc tctggtgggt ccacctggag agcctcgtcg ccctcgccat gggctaccgc 960 ctcaccggcc gcgacgcctg ctgggcctgg tatcagaaga tgcacgacta cagctggcag 1020 cacttcgccg accctgagta cggcgagtgg ttcggctacc tcaaccgccg aggcgaggtc 1080 ctcctcaacc tcaagggcgg caagtggaag ggctgcttcc acgtcccccg cgccatgtac 1140 ctctgctggc agcagttcga ggccctcagc taatgcat 1178 < 210 > 4 < 211 > 1043 < 212 > DNA < 213 > Artificial Sequence < 220 > < 22 3 > N-acetylneuraminic acid synthase < 400 > 4 tctagaatgc agatcaagat cgacaagctc accatcagcc agaagaaccc cctcatcatc 60 cccgagatcg gcatcaacca caacggcagc ctggagatcg ccaagctcat ggtcgacgcc 120 gccaagcgag ccggcgccaa gatcatcaag caccagaccc acatcgtcga ggacgagatg 180 agccaggagg ccaagaacgt catccccggc aacgccaaca tcagcatcta cgagatcatg 240 gagcagtgcg ccctcaacta caaggacgag ctggccctca aggagtacgt cgagaagcag 300 ggcctcgtct acctcagcac ccccttcagc cgcgccgccg ccaaccgcct ggaggacatg 360 ggcgtcagcg cctacaagat cggcagcggc gagtgcaaca actaccccct gatcaagcac 420 atcgcccagt tcaagaagcc catgatcatc agcaccggca tgaacagcat cgagagcatc 480 aagcccaccg tcaagatcct ccgcgactac gagatcccct tcgtcctcct gcacaccacc 540 aacctctacc ccacccccag ccacctcgtc cgcctccagg ccatgctgga gctgtacaag 600 gagttcaact gcctctacgg cctcagcgac cacacgacga acaacctcgc ctgcatcggc 660 gccatcgccc tcggcgccag cgtcctggag cgccacttca ccgacaccat ggaccgcaag 720 ggccccgaca tcgtctgcag catggacgag agcaccctca aggacctcat caaccagacc 780 caggagatgg tcctcctccg cggcgacaac aacaagaacc ccctgaagga ggagcaggtc 840 accat cgact tcgccttcgc cagcgtcgtc agcatcaagg acatcaagaa gggcgagatc 900 ctcagcatgg acaacatctg ggtcaagcgc cccagcaagg gcggcatcag cgccaaggac 960 ttcgaggcca tcctcggcaa gcgcgccaag aaggacatca agaacaacat ccagctcacc 1020 tgggacgact tcgagtaatg cat 1043 Page 3 r57503-2010-12-22-seq_list_ST25.txt < 210 > 5 ≪ 211 > 20 < 212 > DNA < 213 > Artificial Sequence < 220 > ≪ 223 > Primer < 400 > 5 gtggtgtgca ggaggacgaa 20 ≪ 210 > 6 < 211 > 22 < 212 > DNA < 213 > Artificial Sequence < 220 > ≪ 223 > Primer < 400 > 6 caagcacatc gcccagttca ag 22 < 210 > 7 ≪ 211 > 20 < 212 > DNA < 213 > Artificial sequence < 220 > ≪ 223 > Primer < 400 > 7 gcgatcttga gccagttctc 20 ≪ 210 > 8 < 211 > 20 < 212 > DNA < 213 > Artificial Sequence < 220 > ≪ 223 > Primer < 400 > 8 gctacttcac ctgcctcgac 20 < 210 > 9 < 211 > 23 ≪ 212 > DNA < 213 > Artificial Sequence < 220 > ≪ 223 > Primer < 400 > 9 aattccttct agagatatgc atc 23 < 210 > 10 < 211 > 23 < 212 > DNA < 213 > Artificial Sequence < 220 > ≪ 223 > primer Page 4 • · * · · r57503-2010-12-22-seq_list_ST25.txt < 400 > 10 tcgagatgca tatctctaga agg 23 < 210 > 11 < 211 > 24 ≪ 212 > DNA < 213 > Artificial Sequence < 220 > ≪ 223 > Primer < 400 > 11 ctgcgacact cagaacatgt acgt 24 ≪ 210 > 12 < 211 > 22 < 212 > DNA < 213 > Artificial Sequence < 220 > ≪ 223 > Primer < 400 > 12 gctctgcttg gaacctgatt ga 22 < 210 > 13 ≪ 211 > 21 < 212 > DNA < 213 > Artificial Sequence < 220 > ≪ 223 > Primer < 400 > 13 ggtctggtcg tccttgatgc t 21 < 210 > 14 < 2ll > 23 ≪ 212 > DNA < 213 > Artificial Sequence < 220 > Pn mer < 223 > 23 < 400 > 14 tggatcgtca actggttcta cga < 210 > 15 < 211 > 23 ≪ 212 > DNA < 213 > Artificial Sequence < 220 > ≪ 223 > Primer < 400 > 15 gcatgtgtag caacgtggtc ttt Page 5 23
权利要求:
Claims (9) [1] 1. An isolated nucleic acid molecule comprising at least one promoter active in fungus cells, to which one nucleic acid sequence coding for an N-acetylglucosamine 2-epimerase and / or one N-acetylneuraminic acid synthase is operatively linked, wherein the at least one promoter active in fungal cells constitutive promoter. [2] 2. Nucleic acid molecule according to claim 1, characterized in that the fungal cells belong to the genus Trichoderma. [3] 3. Nucleic acid molecule according to claim 1 or 2, characterized in that the fungal cells are Trichoderma reesei cells. [4] 4. Nucleic acid molecule according to one of claims 1 to 3, characterized in that the constitutive promoter is selected from the group consisting of promoters of Glykolysegene, in particular pki, gpd or zwi, tefla, act, cox4, negl and sarl. : 3, vector comprising a Nuk. * Acid molecule according to any one of claims 1 to 4. o. Mushroom row comprising a nurseic acid molecule according to one of claims 1 to 4 or a vector according to claim S. [5] 7. fungal cell according to claim 6, characterized in that the fungal cell belongs to the genus Trichoderma. [6] 8. fungal cell according to Ansprucn 6 or 7, characterized in that the fungal cell is Trichoderma reesei. [7] A fungal line according to any one of claims 6 to 8, characterized in that it comprises at least one nucleic acid molecule encoding its nucleic acid sequence for an N-acetylglucosamine-2-epimerase and an N-accylneuraminase synylase and operably linked to a fungi-active constitutive one Promoter is bound - 23 - [8] 10. A tempting agent for the preparation of N-acetylneuraminic acid (NeuNAc) comprising culturing fungal cells according to any one of claims 6 to 9 in the presence of an N-acetyl-D-glucosamine source. [9] 11. The method according to claim 9, characterized in that the N-acetyl-D-glucosamine source is chitin. AP / pc
类似技术:
公开号 | 公开日 | 专利标题 EP3201316B1|2020-02-19|Method of cultivating microorganisms having nitrile hydratase activity RU2732228C1|2020-09-14|Novel promoter and method of producing purine nucleotides using same EP2655608B1|2016-06-29|Process and means for the production of n-acetylneuraminic acid | EP2848694B1|2018-08-01|Method for producing methacrylic acid ester CN105039464A|2015-11-11|Process and materials for production of glucosamine and n-acetylglucosamine US9617570B2|2017-04-11|Acid resistant yeast cell and use thereof US10696991B2|2020-06-30|Nepetalactol oxidoreductases, nepetalactol synthases, and microbes capable of producing nepetalactone WO2006041226A1|2006-04-20|Improved hydroxynitrile lyase RU2683551C1|2019-03-28|Microorganism which possess productivity of l-lysine, and method of producing l-lysine using this microorganism US8486666B2|2013-07-16|Removal of the guanine cap on the 5′ terminus of RNA EP3839051A1|2021-06-23|Method for the fermentative production of guanidinoacetic acid JP2020089297A|2020-06-11|Polylysine producing bacteria and methods for producing polylysine using the same EP3205728B1|2019-11-27|Process for producing 7-dehydrocholesterol and vitamin d3 CN111394288A|2020-07-10|Recombinant corynebacterium glutamicum, construction method thereof and method for producing tetrahydropyrimidine by using recombinant corynebacterium glutamicum EP3225694A1|2017-10-04|Method for the production of acrylamide by defined addition of the biocatalyst Mishra et al.2017|Process optimization for the production and purification of an extracellular ribonuclease from a soil bacterial isolate RNS3 using one-factor-at-a-time | approach JP2022513674A|2022-02-09|Designed biosynthetic pathway for producing 2-oxoadipic acid by fermentation JP5954539B2|2016-07-20|Method for producing 1-benzyl-4-hydroxy-3-piperidinecarboxylic acid alkyl ester EP3887517A1|2021-10-06|Engineered biosynthetic pathways for production of 1,5-diaminopentane by fermentation
同族专利:
公开号 | 公开日 DK2655608T3|2016-08-01| US20150167038A1|2015-06-18| WO2012083329A1|2012-06-28| AT510299B1|2012-03-15| CA2822301C|2019-08-06| US20130266987A1|2013-10-10| US10106827B2|2018-10-23| EP2655608B1|2016-06-29| CA2822301A1|2012-06-28| EP2655608A1|2013-10-30|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题 US5610034A|1987-04-29|1997-03-11|Alko Group Ltd.|Immunoglobulin production by trichoderma| JP3131655B2|1992-02-03|2001-02-05|マルキン忠勇株式会社|Method for producing N-acetylneuraminic acid| GB9311873D0|1993-06-09|1993-07-28|Glaxo Group Ltd|Process| CN1226417C|1999-02-09|2005-11-09|协和发酵工业株式会社|N-acetylgucosamine 2-epimerase and DNA encoding the enzyme| US6846656B1|1999-08-30|2005-01-25|Kyowa Hakko Kogyo Co., Ltd.|Process for producing N-acetylneuraminic acid| US7863020B2|2000-06-28|2011-01-04|Glycofi, Inc.|Production of sialylated N-glycans in lower eukaryotes| AU8479301A|2000-08-11|2002-02-25|Cornell Res Foundation Inc|Production and use of inducible enzymes from trichoderma and bacteria for control of plant pests and for industrial processes| FI120310B|2001-02-13|2009-09-15|Valtion Teknillinen|An improved method for producing secreted proteins in fungi| AU2003220850A1|2002-02-28|2003-09-09|Kyowa Hakko Kogyo Co., Ltd.|Process for producing n-acetylneuraminic acid| AU2005224672B2|2004-03-17|2011-06-02|Glycofi, Inc.|Method of engineering a cytidine monophosphate-sialic acid synthetic pathway in fungi and yeast|EP3149188A1|2014-05-27|2017-04-05|Universitetet I Tromsø - Norges Arktiske Universitet|Use of a n-acetylneuraminate lyase derived from the bacterium aliivibrio salmonicida in the production of neuraminic acid and derivatives thereof| AT517831B1|2015-12-30|2017-05-15|Technische Universität Wien|Process for the production of secondary metabolites| EP3562951A1|2016-12-27|2019-11-06|Inbiose N.V.|In vivo synthesis of sialylated compounds| EP3473644A1|2017-10-17|2019-04-24|Jennewein Biotechnologie GmbH|Fermentative production of n-acetylneuraminic acid| EP3486326A1|2017-11-21|2019-05-22|Jennewein Biotechnologie GmbH|Method for the purification of n-acetylneuraminic acid from a fermentation broth|
法律状态:
2021-08-15| MM01| Lapse because of not paying annual fees|Effective date: 20201222 |
优先权:
[返回顶部]
申请号 | 申请日 | 专利标题 AT0211110A|AT510299B1|2010-12-22|2010-12-22|METHOD AND AGENT FOR PRODUCING N-ACETYLNEURAMIC ACID |AT0211110A| AT510299B1|2010-12-22|2010-12-22|METHOD AND AGENT FOR PRODUCING N-ACETYLNEURAMIC ACID | US13/993,979| US20130266987A1|2010-12-22|2011-12-22|Method and agents for producing n-acetylneuraminic acid | PCT/AT2011/000510| WO2012083329A1|2010-12-22|2011-12-22|Method and agents for producing n-acetylneuraminic acid | EP11808130.6A| EP2655608B1|2010-12-22|2011-12-22|Process and means for the production of n-acetylneuraminic acid | DK11808130.6T| DK2655608T3|2010-12-22|2011-12-22|METHOD AND MEANS FOR THE PREPARATION OF N-acetylneuraminic | CA2822301A| CA2822301C|2010-12-22|2011-12-22|Method and agents for producing n-acetylneuraminic acid | US14/515,120| US10106827B2|2010-12-22|2014-10-15|Method and agents for producing N-acetylneuraminic acid | 相关专利
Sulfonates, polymers, resist compositions and patterning process
Washing machine
Washing machine
Device for fixture finishing and tension adjusting of membrane
Structure for Equipping Band in a Plane Cathode Ray Tube
Process for preparation of 7 alpha-carboxyl 9, 11-epoxy steroids and intermediates useful therein an
国家/地区
|